Blastocladiella emersonii clone report

Clone ID BeCSAS2583
Best BLASTX Match ref|XP_659604.1|
Function Description hypothetical protein AN2000.2 [Aspergillus nidulans FGSC A4]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2583
CGGTCCGGACCCCCGGGCTCTCACCCGCGAACTAGCACCCACTCAGCAGC
ACTACCCCACCATGCAGATTTTCGTCAAGACCCTCACGGGCAAGACCATC
ACCCTCGAGGTCGAGTCGTCGGATACGATCGACTCGGTCAAGACCAAGAT
TCAGGACAAGGAGGGCATCCCGCCCGACCAGCAGCGCCTCATCTTCGCCG
GTAAGCAGCTCGAGGACGGTCGCACGCTGTCCGACTACAACATCCAGAAG
GAGTCGACGCTGCACCTCGTCCTGCGTCTGCGCGGCGGCATGCAGATCTT
CGTCAAGACCCTCACGGGCAAGACCATCACGCTCGAGGTCGAGTCGTCGG
ACACGATTGACTCGGTCAAGAGCAAGATTCAGGACAAGGAGGGGATTCCC
CCGGACCAGCAGCGCCTGATCTTCGCGGGCAAGCAGCTCGAGGACGGCCG
CACGCTGTCCGACTACAACATCCAGAAGGAGTCGACGCTCCACCTCGTCC
TGCGTCTGCGCGGCGGCATGCAGATCTTCGTCAAGACCCTCACGGGCAAG
ACGATCACGCTCGAGGTCGAGTCGTCTGACACCATTGACTCGGTCAAGAC
CAAGATCCAGGACAAGGAGGGCATCCCCCCGGACCAGCAGCGCCTTATCT
TCGCCGGTAAGCAGCTCGAGGACGGCCGCACGCTCTCGGACTACAACATC
CAGAAGGAGTCGACCCTGCACCTCGTCCTGCGTCTGCGCGGCGGCCAGTA
GGTGGCCGCGGCCGTGTCGTGTCGTCTTGTCCGATGTCGTCGGATGTAAA
TTTGTCCATACAGCATTCCATCACCA