Blastocladiella emersonii clone report

Clone ID BeCSAS2582
Best BLASTX Match ref|XP_569186.1|
Function Description hypothetical protein CNB03510 [Cryptococcus neoformans var. neoformans JEC21]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2582
CACGAACCCAAATGCCCATCACGCTGCTGCACAACAAGCACGCGCACGCC
GTGGCGTTCGACCGCCCGCTGTCGATGGTGACGCTGGCCGAGCTGGTGGC
GACGGCCGCCGCGACGCTGGGCGTGCCACAAGCCGGCCTGCGCCTCGTCT
ACAACGGCGGCATCCTCAAGGACACGTCCGCGACGCTCGCCCAGTACGGC
CTGCACGCCGACTCGCGCGTCCTCGCCCTCGCCTCGCAGGGCCCACCGCG
CGCCCCCGAGCCGTCCATTGCCCCGCTCCAGCCAGCCTACACCCCCGCGG
CCCCTTCCCCCGCATCAGCACCAACGGCCAACCTCGCGTCGGCCGACCCG
CGCGAGCAGGCCGTGATCGCGACCGTGTCGGACCTGCTGGCGGGCGCCAT
GGCGCCGCTGAACCCGCTGCTGGACCGGTTTGCGCGCGCGCCGGCCGCGG
GCCCGCCGTCGCCCGACGTGACCAAGCTCAAGGGCGAGATCGGCGAGCGC
CTGATGCAGGCGCTGCTCAAGGTCGACGGCGTCGCGGTCCCGCCCGGGTT
CGAGGTCGCCCGCGCCAAGCGCCGCGAGGCCGTCAACACGCTGCAGGCGC
TCATGGACGAGGTCGAGGCGCGGTATCGCGCCATGATGGGCAAGCGCGCC
TGAGCAAGTAAATACACTAGTCTAGCTTG