Blastocladiella emersonii clone report

Clone ID BeCSAS2579
Best BLASTX Match ref|XP_973141.1|
Function Description PREDICTED: similar to CG2976-PA [Tribolium castaneum]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2579
CGCGGGCGCGGGCGCGCTGGTCGACGCGGAGAAGAAGTTTACCGCGGTGC
TCCTCGAGGACGACGCCAAGAACTACCACACGTGGAACTACCGCCAGTGG
CTCGTGTCGACGTACAACGCGTGGGACGGCGAGCTCGACCTGACGGACTT
GCTGCTGGCGGCCGACGTGCGCAACAACTCGGCGTGGACATACCGGTTCT
TTATGCTGTTCGGGTCCGAGCAGCTCGCGGGCCGCGTCATGGACGTGGAC
GTCGACGCCGAGCTCGACGCTACGGTCGCCGCGATCCGCCGCGCACCGTC
GAACGAGTCGCCGTGGGTGTACCTGCGCGGGGTGCTCAACCACCAGAACA
TGGCCACGGCGCCCGAACGCGTCATGGACGCGTGCAAGACGCTGGTCGCG
GGCAACTGCATGTCGCCGCACTTGTTCGCGTTCCTCGTCGACGAGTACGC
GGCGCTGGGCGACCTCGAGGCGGCGCGTTCGACGTGCGAGCACCTCGAGC
AGACGGTCGACCGCACGCGCAAGCGGTACTGGGCGTACCGCCGCGCGCAG
CTGGTTCAGTAGCGGGACGATGAGCGCTAAGAAGAAAAGTATATCCTGTT
TTGATTCGGACGC