Blastocladiella emersonii clone report

Clone ID BeCSAS2578
Best BLASTX Match dbj|BAE55863.1|
Function Description unnamed protein product [Aspergillus oryzae]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2578
CGCAACTCCCCGCAACATGGATCACCTCTTTGGCGGCTTTGGCAGCGCCG
GGTTCGGCTTTGGCGGGAATGGCACGGGCACCTTTTCGGAATACGTGTGT
CTTGCTACCACCGGGGAGGCTAGGTTTCGATGTCTTACGCGAGTCGTGGA
TGTGTAGTACCGGTGCTACTCGGTGGCGATGGCGCCAGGCAAGGAGCGCG
AGACGCTGAACCACGGGTCCGGAGGTGCGCCCGCTTCTCACATCGGCGCT
CTTGTGCAGCGTTGCTGACCACGTCTCACACACTAGTCATTCTCCCGCCA
TCGGCCCTCGCCAAGCTGACCCAGTACAACGTGACGACGCCGTACAAGTT
TGCGCTGACCAACGAGCAGACGCAGAAGACGACGCACGCGAGCGTGCTCG
AGTTCATTGCCGAGGAGGGCCGCATCTACCTCCCGCGGTGGATGATGGCG
ACGCTGGGCGCCGGCGAGGGCAGCCTGCTGCAGGTCAAGTCGGCGACGCT
GCCGCGTGGCAAGTTTGTCAAGATCCAGCCGCAGAGCGTCGCGTTCCTCG
ATATCTCGGATCCCAAGGCTGTCCTCGAGCGCGCGTTCCGCAGCTACCTC
GCCATGACGCTGGGCGACAAGCTGTCGTTCGTGTACGCGGACCGCGAGTA
CCAGATCGAGGTGCTGGAGCTGAAGCCGTCGCACGCCGTGTCGCTGATCG
ACACGGACCTCGAGGTCGACTTCGCGCCGCCCGTCGGGTACGTGGAGCCG
TCGCTGCAGCGCCCCGGCAGCGCCGGGTCCGGGCTCGGCGGCAGCCACGC
GAGCGTGCGCGACGAGATTCTGCAGCACGTGGTCGTCGAGAAGCGCGGAT
GGGACCTGCTGTCGTCGGGCCAGCGGCTCAACGGCAAGTCGGCGACGGCC
GTCTCGGGCAACCAGAAGCGCGCCCGCGGCACCGGCTCCCTCGTCAACGC
CGACGAGATCCGGCCCTCGCTCGACGGCGAGACCCCGCTCCCGCTCCGGC
TGCCCCTCGGCCAGCTGTTCTTTGGGTTCAACGTGCCGTCCGCGACGGGC
GGCGCANCGGGCGGCGAAGGGGATGATGGCGAGCCCAAGTCAAGGGTGAG
G