Blastocladiella emersonii clone report

Clone ID BeCSAS2573
Best BLASTX Match gb|ABF18308.1|
Function Description calponin [Aedes aegypti]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2573
TGGTCGCCTGCAGGTCCGGTCCGGACTTCCGGGTCGACCCCGCGTCCGTG
AAAACCATGGCGTCCGAGGTCCCCATCTACGGCATCGACAAGGAGATCAA
GCGCAAGCTCGACTCGAAGCTCTCGCCCGAGCAGATCGAGGACGCCCGCG
TGTGGATCCAGGCGGTCCTCGGGCGCGACGTGCCCGTGCTCGACCAGCCG
ACGCTCAAGGACGGCACGCTGCTGCTCGAGCTGCTGGCCAAGGTGACGGG
GCAGACGGTCAAGATCCAGCGCTCCAACATGCCCTTCAAGCAGATGGAGA
ACGTCAGCCAGTTCCTGCTCGGCGCCGAGAAGCTCGGGTGCCCCAAGTTC
GAGCTGTTCCAGACCATCGACCTGTTCGAGGACAAGAATTTCGGACAGGT
CATCATTGCGCTCTTCTCGTTTGCGCGCCACGCGCAGAAGTCGGGCGCCG
ACGTGCCGCTGCTCGGGCCCAAGCTCAACGACAAGCATGAGGTCAACTTT
AGCGACGAGCAGCTCAACGCCGGCAAGTTCATTCCCTCGGCCCAGACCGG
CGGCATGAACCCCAAGCAGGAGACGGGTCTCGGCTTCGGCATCCCGCGCC
AGATCGTGGACCCGCGCCTCGGCGAGTCGGTCGCGCCCAACCTCCCCTCG
CAGCACACGTCCGGCTTCACGGGCGGCGCCAACGCCTCGGGCGTCGTGTA
CGGCAAGCGCCGCGAGCCCGTGTACAAGGACTAGACGCGCTGCGCTGGCC
CGCGGGCAGACTCGACTTGACTCGACTCGAAGTGAACAGTGCTGTATTTG
TCTCGTCATACATATAAAACGTTGTTGATCC