Blastocladiella emersonii clone report

Clone ID BeCSAS2571
Best BLASTX Match gb|AAW45850.1|
Function Description arp2/3 complex 21 kda subunit (p21-arc), putative [Cryptococcus neoformans var. neoformans JEC21]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2571
CGAATGGACTTCTTTGAACCGGCCGACCTCGACTCGGAAGACCCCGCATC
AGCCGCCCTCGCGCTCGGCTCCTCGCTCGCCGCCGCCCACCCCGTCCTCG
TCCGCCTCGCTCTCGGCGCCGCCCTCGTCTGCGTCGCCCTGCTCCGCCCC
TCGGCTTTCGTCGGCTTCTTCCTCGCCCTGTCGCTGCTCTACGTCGGCTA
CGCCTACTTCTGATCCTCCTCCTCGACCATGCCCGTCTACCACTCGTCCT
TCAACGCCATCGAGGACGTGCCGCAGGTCGGCAACATGGCCGTGCTGCCG
CTCAAGGCCAAGACGCGCGGATTCGCGCCCGTGGCCGCGGACCCGGCCGC
CGACGACATCGTCGACGAGGCGCTGGACCTGTTCCGCGCCAACTCGCTGT
TCCGCAACTTTGAGATCCAGGGCCCCGCCGACCGCGTGCTCATCTACCTG
ATCCTGTTCACGTCCGAGTGCCTCGGCAAGCTGACGCCGGCCACGACGCG
CGACGCCGCAAACAAGCTGCTCTACGCGCTCGCTGTCGGCCCCTTTGCCA
TCCCCGGCGAGGGCTCGTTCCCGCTCAACGCCCTCTACGCCGCCCCCGCG
ACCCGCGCCGACGCCGACAACATGAAGGCCTACCTCCAGCAGCTGCGCAC
CGAGCTC