Blastocladiella emersonii clone report

Clone ID BeCSAS2569
Best BLASTX Match ref|XP_749237.1|
Function Description myo-inositol-phosphate synthase [Aspergillus fumigatus Af293]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2569
CCGCGCCTCGGGTACGTTTTTTCACGCGAGGTGTGTGCGCCCGTGCTGCG
CGACTGGAGCTAACCGCCGCCACCGACCCACTCCCACGCACACAGTGTCA
TGCTCGTCGGCTGGGGCGGCAACAACGGCTCGACCCTGACGGCGTCCATC
ATCGCCAACCGCAACCAGCTGTCGTGGGAGACGCGCGAGGGCACGCAGAA
GGCCAACTACTACGGCTCGCTCGTCATGGCGTCGACGGTCAAGCTCGGCG
TCGACGCCGAGGACCCGACCAAGGAGATCTACGTGCCCCTGCACGACATG
CTGCCCATGGTGCACCCCAACGACGTGGTGATCGGCGGCTGGGACATTTC
GGGCCTCAACCTCGCCGACGCCATGGACCGCGCCAAGGTGCTCGAGCCCG
ACCTCCGCCGCCAGGTCCGCGACGAGATGCGCGCCATGGTCCCGCTTCCG
TCGGTCTACTACCCCGACTTCATCGCGTCCAACCAGGAGGAGCGCGCCGA
CAACGTGCTGCCCGGCAACGACAAGCAGGCCCACCTCGACCGCCTGCGCC
AGGACATGCGCGACTTCAAGGCCGCGCACGACCTCGACAAGCTCGTGGTC
CTGTGGACCGCCAACACGGAGCGCTTCGCCGACCTCGTCGACGGCGTCAA
CGACTCGGCCGACAACCTGCTGGCCGCGATCGCCCGCTCCGAGGACGAGG
TGTCGCCGTCGACCGTGTTTGCCGTGGCGTCGATCCTCGAGGGCCACACG
TTCATCAACGGGTCGCCGCAGAACACGTTCGTGCCCGGCGTGATCGAGCT
CGCCGAGCGCCACCGCGTGCAGATTGGCGGCGACGACTTCAAGTCGGGCC
AGACCAAGGTCAAGTCGGTGATCGTCGACTTCCTCGTCAACGCCGGCATC
AAGCCGCTGTCGATTGCGTCGTACAACCACCTCGGCAACAACGACGGGCG
CAACCTGTCGGAGCACAAGCAGTTCCGGTCCAAGGAGATCTCCAAGTCGT
CGGTCGTCGACGACATGGTGGCGGCCAACCCGATCCTGTACGCGGACGGC
GAGCACCCGGACCACATTGTGGTGATCAAGTACGTGCCGTCGGTCGGCGA
CTCGAAGCGCGCGCTCGACGAGTACAACTCGGAGATCTTCATG