Blastocladiella emersonii clone report

Clone ID BeCSAS2564
Best BLASTX Match ref|XP_866843.1|
Function Description PREDICTED: similar to dynein light chain-2 isoform 2 [Canis familiaris]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2564
CGTAACTGGGTGCAAACGAATCTCCAAGACCACCCTCCTCCCCATACACA
CAGCAGCAACCACCACCATGTCTGAGCGCAAGGCCATCATCAAGAACGCG
GACATGTCCGAGGAGATGCAGCAGGACGCCGTCGACTGCGCGACCCAGGC
CATGGAGAAGTACAACATCGAGAAGGACGTGGCCGCCTTCATCAAGCGCG
AGTTCGACAAGAAGTACAACCCCACGTGGCACTGCGTCGTCGGCCGCAAC
TTTGGCTCTTACGTGACGCACGAGACCAAGGTACGCTCCGATTCGACTGC
GTCGTCCTCGTCCTCGACCGCTTCCTCGTCCTCCCCGTCGTCGACTGCGT
CCTCGTCCTCTCCCTCGTCGTCCTCGTCGCCCTCTACCGTCTCCTTGTCC
TCGTCGACCTCGACCACCCCGTCGTCCTCGACCACCGCCTTTACGCAGCC
ACTGACGCACCCCCGTCGCCGCGCTCGTAGCACTTCATCTACTTCTACCT
CGGCCAGATCGCCATCCTGCTGTTCAAGTCGGGCTGAGCACCGTCCCTCG
CGCGGCGTCTCACCACGGCGCCGCGGCGCTGGTCGCGGCCCTCGCTCATC
GTCACCGTCGTCTCCTCCCCTTTGTGAATTCTAGTTTTTTTTATTCGT