Blastocladiella emersonii clone report

Clone ID BeCSAS2558
Best BLASTX Match dbj|BAD63185.1|
Function Description chitinase [Bacillus clausii KSM-K16]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2558
CCTGCGGTCCGGTCGGACTCCCGGGTCGACCCCGCGTCCGAGCAGCCCTT
CCCCTACCTTGCAACGCATCACCACCATGGTCCACAACCCCGTCGTCGGC
GCCTACTACTGCTCGTGGACCGTCTACGACCCGCGCGCCTACACGCCCGA
CCAGATCCCCGTCGAGAAGCTGACGCACCTGTACTATGCGTTCGCCAACA
TCTCGGCCGAGGGTGTGATCGTGCCGGGCGACCAGTGGGCCGACGTCGAC
AAGCCGTACACGGCGCGCAACGGGACGCAGCTGCGCGGCGCCTTCCAGGT
GCTCAACCACCCGCAGGGCCCGCTGCGCCAGCGCAACCCCAACTTTCGGT
CGGTCATCAGCATCGGCGGCTGGACCATGTCCAAGGAGTTCTCCAACGTG
GCCCGCACCCCCGAGTCGCGCGCCAAGTTCACCAAGTCGGTCGTCGACTT
TGTCGCCCTGCACGGGTTTGACGGCATCGACATCGACTGGGAGTTCCCCG
TCGAGGGCGGCCTGCCCGCCAACTCGCGGTGCCCGCAGGACGGGCAGAAC
CTGACGCTGCTGTGTGAGTCGCTGCACCGCGCGCTCGCTCAGCTCGCGCA
GCAGACGGGCCGCCGCTCGCCGTACTGCATCTCGGCGGCGGTCCCGCACG
CCGAGTGGCTGTACCGGCACTTTGACCTGGCGGGGCTCGCCAAGTACTGC
GACCACCTGCTCGTCATGACGTACGACGCGACGGGCGCGTGGTCCAAGGT
GACGGGCCACCACGCCCCCGTGTCGTGCATCCAGACCGCCGTCCAGGGGT
ACACGCAGCGCGGCGTGCCCGCCGCCAAGCTGCTCGCGGGGCTCCCGCAG
TCGGGCCGCGCGTTCGGTGGGGTCAAGTCGCCCGCCGTCGGCAGCCCGCT
GACCCCCGGTACCGGCCCGGGTACCCACGCCAAGGGGATCGTCGACTGGG
ACGACCTCCGCATCAACTACACCCCCGCCAAGGGGTACACGGCCTCGTTC
GAT