Blastocladiella emersonii clone report

Clone ID BeCSAS2557
Best BLASTX Match ref|XP_750544.1|
Function Description hypothetical protein Afu6g06520 [Aspergillus fumigatus Af293]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2557
GCGTCCGCACCCACACGCACACGCACCCGCCATGGTTTCGACCCGCGACG
AGCGCCCCGACCTGGTCATGGGCGGCTACCGCGGCGCCCCTGCTCCCGCT
GTCGACACGGACGCGCCCATCGACACGACGGGCCCGGCGTGCGGCGACGC
GTACTACGGCCCGTACCTCAAGTTCCTCGGCACCGACGTCGCCACCTCCA
CGGCGCGCTACTCGGTGCTCGTCGTCGCCAAGCCCGACTGCACCGCCCCG
CCCGCCGTCCGCGTGTACGCCGCGACGCTGCCCGCGACGCCCGACTTGGC
GCCGCGCGTCGTCGACGCGCCCGTCCTGCTCGACACCTTCGCCGACCACC
GGTTCTGGCGCACCGAGCTCGCCGTGCCCATGCCCGCCGGGTTTGGCGGG
GTCGAGATCCGCTACGCGGTCCCCGGCACGCGCAGCCGCTCGGGCGAGTA
CGCGTTCCACGTCCCCGGCCAAGACATGCAGTGGAACTGGGCGTTCACGT
CGTGCAACGGGTTCTCGTCCGACGTGGCGCGCGGCGTCGAGCACGAGTAT
AACGGCATTGCCCCGCTGTGGCGCGACGTGCTCCGCAAGCACGACGAGGT
CAAGTACCACGCCATGCTCGGCGGCGGCGACCAGGTCTACATGGACGCCG
TCTGGGGCCTTCCCGAGCTCCAGCAGTGGCTCGACACCCCCGCCAAGGCC
GACAAGGCGACGGCGCCCTTCACGCGCGGCATGAGCGACGCCGTGCACGG
CTTCTACTTCGCCGAGTACCTGCGCCATTTCGCCAAGGACGGCTTCGCCG
ACGCGCTGGCCTCGATCCCGTCCATGTTCGTGTGGGACGACCACGACATT
TTCGACGGCTACGGGTCGTACCCGGGCTACCTGCAGTCGTCGCCCGTGTT
CCGCGGCATGTTCATTGCCGCGCAGCGCTTCTACCTCCTGTTCCAGCACC
ACACCACCCTCGCCCTCGCCCGCGACGACGGGTACCTGGGGGTCGAGCGC
GGCGGCCACACGGCGGTCCGCCAGATGGGCCAGTACAACGCGGCGCTGCT
CATCGACACCCGCACCGAGCGCTCGATTTCGGCGCTCCTGTCGCGCGGCT
CGTGGGCGCTCATCGAGGACGCCCTGCGCACGCAGCTCGCGCCCACCACG
CGCCACCTGTTCGTGTGCGCGACGGTGCCCATGGTGTACCCGCGCCTGCA
TGCCGAGTCGGCCATCTCGGTCGCGGGCATCGCGGCCAACGCCATCGGCA
AGCTGGCCGGCAACGCGCCTTGGTTCGCGTCCCTGAAAAAGACGGGCGCG
TTCAAGACCATCGTCAACTCGCTCGGCGAGCCCGAGCTGCTCGACGACCT
CAACGACCACTGGACGTCCGCCAACCACGTCGCCGAGCGTAATGCGGCGC
TCGACATGCTCGGCCGCATCGCGCACGAGCGCGGCAACCTGCGCATCACG
CTCGTCTCGGGCGATGTGCACTGCGGCGGCGCGGGCCACATCTTCCCGTC
GTCGGTGCCCGCGAACCACTGGCTCAACCACCCGGCGCACATGACGCAGA
TCATCAGCTCGGCCATCGGCAACATCCCGCCGCCCGGCATCGTGATCCGC
GCGCTGCACGCGGTCGCTAAGCCGCTCGCCGTCTCGGGGGGCGCCGACCA
CGACGCGGATGGGCTGACCGAGGCCATGCTCGCGCCGTTCGACGTGGACG
CGGGCAAGCCGACGCACAAGCTGCCCGCCGACCAGCGCGCGCTCATGGGC
CGGCGCAACTGGTGCAGCGTCGAGCCGCGCGGCGCCATGGCGGGGTCCGT
CCCGTTCGAGCTGCGCGTCGAGGTCACAAGGG