Blastocladiella emersonii clone report

Clone ID BeCSAS2556
Best BLASTX Match gb|AAH77210.1|
Function Description Acadm-prov protein [Xenopus laevis]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2556
CGTAGTTCTCTTCCATGATGCTTCGCACTGCTGCTGCCCGTCTGGCGTCC
ACGCCCGCCGCCACGCGCGCCTTCGCGTCGGCGTCTGCCGCCCCCGCCGG
CGTCTCGTTCGTGCTGTCCGAGACCCAGCGCGAGTTCCAGGAGCTCGCCC
GCAAGTTTGCCGCCGAGGAGATCATCCCCAAGGCCGCGCACCACGACCGC
ACCGGCGAGTTCCCCAAGGAGATTATCAAGAAGGCGTGGGAGCTCGGTCT
CGTCAACATCCACATCCCCGAGGCCTACGGCGGCCTCGGCCTCGGCGTGT
TCGACGGCGCCCTCATCTCCGAGGAGCTGGCCTTCGGCTGCACCGGTGTC
CAGACGGCTATCGAGGCCAACGGTCTTGCGCAAGCGCCCGTGATTCTCGC
TGGTAACGACGCCCAGAAGAAGAAGTACCTCGGCCGCATGACCGAGGAGC
CGCTCATGGCCTCGTACGGTGTGACCGAGCCCGGCGCCGGGTCCGACGTC
GCTGGCCTCAAGACCCGCGCTGTCAAGAAGGGCGACAAGTACGTTATCAA
CGGTGGCAAGCAGTGGATCACCTCGGCGGGGCACGCAAATTGGTTTTTCG
TGCTCGCTCGCACTGCCGAGGACCCCAAGACGCCCGCCGGCAAGGCCTTC
ACCGGCTTCATCGTCGACGCCGACTCGCCCGGCATCACGCTCGGCCGCAA
GGAGATCAACATGGGCCAGCGCGCCTCCGACACGCGCGCCGTGACGTTCG
AGGACGTCGTGGTGCCCGCCGAGAACGTGCTGGGCAAGGAGGGCGAGGGC
TTCAAGATCGCCATGGGCGCCTTCGACATCACCCGCCCGCTCGTCGCCGC
CGCCGCTGTCGGTCTCGCTCGTCGCTGCCTCCACGAGGCCGCCACCTACG
CCACCCAGCGCAAGACCATGGGCACCGCCATCATCAACCACCAGGCCGTG
TCCTTCATGCTCGCTGACATGGCCATGGGCATCGAGGCCTCGCGCCTGCT
CGTGTGGCGCTCGGCCGAGATGCGCGACCGCGGTGAGCGCAACACGTACT
ACGCGTCCGCCGCCAAGTGCATGGCCGCCGACGTTGCCAACAAGTGCGCC
GCCGACGCCGTCCAGGTCTTTGGCGGTGCCGGCTTCAACACCGAGTACCC
CGTCGAGAAGCTGTACCGCGACGCCAAGATCTTCCAGATCTACGAGGGCA
CGTCGCAGATCCAGCGCGTCATCCTGTCCAAGTTCATCGCCGACCAGTAC
AAGGCCTAAGTCGGCGTGGTCTCGGTCGTTCGTTGTGTGTTGATGCAGAT
GTGTCTTGCCTCTGCCCCGTCTTATATACTCCCCCACTCTCTCCTTGCG