Blastocladiella emersonii clone report

Clone ID BeCSAS2555
Best BLASTX Match ref|NP_689866.1|
Function Description ubiquitin-conjugating enzyme E2E 2 (UBC4/5 homolog, yeast) [Homo sapiens]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2555
GCGTCCGCGGCAGTATCCGCCTGCGAAACGTAACTCTACGCAACGTCATC
AACACCATGAGCGCGACCAAGCGTATCCAGAAGGAGCTCGCCGAGATCAC
GGCGTCGCCCCCGCCCAACTGCAGTGCCGGTCCCAAGGGCGACAACCTGT
ACGAGTGGACCGCCACCATCCAGGGTCCCCAGGGCTCGCCTTACGAGGGT
GGCCTCTTCTTCCTCCAGATCAGCATGCCGCCCGAGTACCCGTTCCGCCC
GCCCAAGGTCACCTTCCAGACCAAGATCTACCACTGCAACATCAACTCGG
CCGGCGGCATCTGCCTCGACATTCTCAAGAACTCGTGGTCCCCTGCCCTG
ACCATCTCCAAGGTCCTCCTCTCCATCTCGAGTCTCCTCACCGACCCCAA
CCCCGACGACCCGCTGGTCGGCGACATTGCGCGCCAGCTCAAGGAGGACA
AGGCCGCCCACGACCAGACCGCGCGCGAGTGGACCAAGCGCTTCGCCTCT
TAACTCGGATTGCTCGCCCCGCACGTTCGACCACCTGCCCCGGCGGCCCC
CTGCGCTTCGCTGCATCGAATAAACTGACCCTTCTGTGCACGCTCGCCCA
ATCGGA