Blastocladiella emersonii clone report

Clone ID BeCSAS2550
Best BLASTX Match gb|AAS53905.1|
Function Description AFR534Wp [Ashbya gossypii ATCC 10895]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2550
CGCGGCGCTCGCGCTGCAGGTGGCCGCCAACGCGCCCGCCAAGCCGGCGG
CCTCGCTGGTCCCGACGCCGCTGACGCCGCTGTCTCTCGGCGCGCGGTCC
TCGACCGCCGCGTCGCCGTCGTTCCGCGTGACGCCGACGCCCGAGACGGC
GGTCCCCGCCGAGCTCAAGCTGCAGTCGGGGCACGTGTTCACGGGGCAGT
GCTACGGCGCGCCGCGCTCGATCGGCGGCGAGGTGGTGTTCACGACGGCG
CTGGTCGGGTACCCGGAGTCGCTGACGGACCCGTCGTACGCGGGCCAGAT
CCTGGTGCTGACACAGCCGCTCGCGGGCAACTACGGCGTGCCCGCGCCGA
CGTACGACCTCGACTCGGGCCTGCCGCAGCGGTTCGAGAGCGACCGGATC
TGGGCGCGCGCGGTCGTCGTGGCCGATTACACGTGGCAGTTCTCGCACCG
CGAGGCCGTCATGTCGCTCGGCGCGTGGTGCCGCGCCCAGGGCGTCCCGA
TCCTCTCGGGCATCGATACCCGCGAGCTCGTCCAGGTCCTGCGCAACCAC
GGGTCGACGCTCGGGACCGTGGCCGTCGGCGGCCAGGAGCAGGTCGCCTT
CGATAACCCGAACGCCACCACCAACCTCGTCGCGTCCGTCTCGACCAAGT
CGCCTGTCGTCTACGGCC