Blastocladiella emersonii clone report

Clone ID BeCSAS2547
Best BLASTX Match emb|CAG00297.1|
Function Description unnamed protein product [Tetraodon nigroviridis]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2547
ACACACAAAGTTCCTAGTTACAGCAGCAAAACTGTTCTCTCATTCAGCAC
ACGCAAGGAATCGGCAGTTACACCTTGGCGTCGTCGAGGACCCGCACGCC
CTTCTCCTCGTAGTCGGAGCGCTTCATCCAGAAGAGCGGGTTGTTCTTCA
TGGTCTCGGCGAGGACGGCGCCGCCGACAAAGACGGCGTGCTTGCGGCCG
GGCGGGTCCTCGACCTTGATCTTGAACTTGCGCATGCGCATGTTGTCGCC
CTTGAGGATGCGCTGCAGGTACAGCTGGCGCACCTCCTTTTCGAGGCGCG
ACGACAGGCCCGGGTACATGGTGGTGCCGCCCGACAGCAAGATGTGCTTG
TACAGCTCGGGGCGGTTGTCGATCGGGCACGCGTTGATGGCGTTGAACAG
CACCTCGGCCACGCCGGGCGACTCGATGTCGACGAGGTGCGGCTGGAACA
GCGCCTCGGGGGCCTCGAACCGCTCGGACCCGACCTTGATGACGCGGCCG
TCGGGCAGCGTGTACTGCTCGACGAGCACCGTGGTCTCGGTGGCCAGCTT
CTGCTCGAGGTCGAGGTCGTAGGCCACGTAGCACAGCTTCTCCTTCATCT
GGCGCACCGTCTCGAAGTCGGCGGTGCGGTTGAAGGCG