Blastocladiella emersonii clone report

Clone ID BeCSAS2545
Best BLASTX Match ref|YP_436726.1|
Function Description Rhs family protein [Hahella chejuensis KCTC 2396]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2545
CGAACACGGCCGAGCTCGCGTGCGAGACGACGGTGGTCTCAGCGGTCAAG
GAGTCGTGCGCCTCGAACCCGCTTGGGACCAGCACCGACTTCAACGCCGT
CTTCTACAACGCCTTCACGCAGTCGTCGGGCCGATCCGAGGGCCGCCTGG
CCATTGGCGGCGCCGCGTCACTCACGGGCTACTCGATCGCCGACAGCGTC
CCAGCGCTCGCGTGTGATGTGGCGGCACTCGTGGTCGGCGGCACGCTCAA
GTTCCCGTCGGGCCGCGTCTACTCGGGCTCGATCCGCGTCGCGTCCAAGG
CCGGCTCGTCGGTCGGCGACCCGGTCCTCACGGGTCTGCAGGGCTGCGCG
ACGTACGGGCTCGCCTCGCCGACCATCGCGTCCGTGTTCGACTTTGACGC
GCACCGCACCGCCATGGTCGCGCTCGCCAACAAGCTGACGTCGCTGCCCG
CGACGCTCGAGATCGCGGCGTCGCCCGCGTGGGGCGCGCGCGTGGTCGTG
CGCAAGGCGCAGCCGGCGGCGGGCGACAGCTTTGAGGTGCTGCCCATCGC
CAAGCCGTCGGCGGGGTCGACGGACGTGCCCGAGATCAACTGGGACTCGG
TGCTCGCGCTGGTTGGCACGTCGCGCACGCTCATCGTCAACCTCGACGCG
GGCGTCACGGTCCGCGGCAACGACTACACCAAGCTCGTCAACTCCGGGAT
CCCCGTCGTGTGGAACTTTGGGGC