Blastocladiella emersonii clone report

Clone ID BeCSAS2541
Best BLASTX Match gb|EAQ91476.1|
Function Description hypothetical protein CHGG_03411 [Chaetomium globosum CBS 148.51]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2541
CCCGGGTCGACCCACCNGCGTCCGGGAGCTCCCACGCACACGAAGCAACC
GACCCACCACAACACCCATCACCACCGTCACCATGGCCGAATCGCGCCAG
GAGCTGCTGCACTGGATCAACAACCTGACGGGGCTCGGGCTGGTCAAGAT
CGAGGAGCTCGGCAAGGGCTACGCGCTGTGCCAGATCTTCGACTCGGTGT
TCCTCGACGTGCCGCTGCGCAAGGTCAAGTTCAACGCCAAGCACGAGTTC
GAGTACATCCAGAACTTCAAGGTGCTGCAGTCCGTCTTCGACAAGCACAA
GATCCCAAACCACATCCCCGTCGAGCGCCTCGTCAAGCTCAAGTTCCAGG
ACAACATTGAGTTCTGCCAGTTTGTGAAAAAGTTCTGGGACTCGCACTTC
CCCGGCCACTTCTACGAC