Blastocladiella emersonii clone report

Clone ID BeCSAS2540
Best BLASTX Match gb|EAQ93381.1|
Function Description ATP synthase gamma chain, mitochondrial precursor [Chaetomium globosum CBS 148.51]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2540
CCTGCAGTCCGGTCCGGAACCCCGGGTCGACCACGCGTCCGCGCACCGCT
GCCCCACAGAACCACCTCCTAACCGTCGTCAAGATGCTGTCGGCCACCGC
CCGCCCCAACGCCCGCGTGGTGTCGCTCCTCCAGCAGCAGGCCACCATGG
CCACGCTCAAGGAGATCCAGATGCGCCTCAAGTCCATCACCAACATCGGC
AAGATCACCAAGTCGATGAAGATGATTGCCTCGACCAAGATGACCCGCGC
CCAGCGCGCCATGGACGCGGCCCGCATCAACGGCACCGCTGCCACGGCCC
TGCTCAAGCACGCCGGCACCCAGCCCGCCGAGGGCCCCAACGGCGCCTTC
ATTGCCGTGTCCTCGGACCGTGGTCTGTGCGGCGGTATCCACTCGTCCAT
CACCAAGAACATCAAGCGCACCGTGGCCAAGGACGGGCCCGCTGAGCTCG
TCGTCCTCGGCGACAAGTGCCGCAACCAGCTCGCCCGCGAGTTCCGCAAC
AACGTGCGCCTCACCTACTCGCAGCTCGGCAAGACGGTGCCCTCGTTCCT
CGAGGCCTCGCTCATTGCCGATGCTGTGCTCGCCGACAAGGACCTGGCCG
CGCTCAAGACGGCCATCGTCTACAACAAGTTCATGACCGTCATCTCGTAC
GAGTCGACGCAGATGCCCGTGGTCTCGGCCGAGGCCCTCAAGGCGTCGCC
CAAGCTCGCCGCCTACGAGACCGAGGGCGATGTGCTCAAGGAGCTGCACC
ACTTCCTCTTCGCCACCTGCCTCCACTGGGCCATGAACGAGGGCCACGCG
TACGAGTTCTCGGCCCGCCGTGGCGCCATGGACAACGCCACCAATAACGC
CGGCGAGATAGTCGACCGCCTCACCCTCCTATACGACCGTCAACGCCAGG
CCTCCATCACCAACGACCTCGCCGACATTATCACCGGTGCCTCAGCCCTG
TAAAGTCGCTCTACTCTCACGCGCGGTTGGTCCTCGCTGGGGGTTGGTTC
ACCGTATCGTGGGCTGCCTTCGCGT