Blastocladiella emersonii clone report

Clone ID BeCSAS2539
Best BLASTX Match emb|CAA19336.1|
Function Description SPCC338.05c [Schizosaccharomyces pombe]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2539
GGCAAAGGGTATGCATCAACTAATCGCAATGTGCAGCGACGACCTGGCCG
ACGAAGCACCCTCACCATGGCAAAGGTCCCGCGTAACTTCCGGCTGCTCG
AGGAGCTCGAGAAGGGCGAGAAGGGCATCGGCGACGGCACCACGTCGTAC
GGCCTGGCCAACCCCGACGACATTCTCATGAGCGACTGGAACGGCACCAT
TCTGGGTCCCCCTCACACGGTCCACGAGAACCGCATCTACTCGCTCAAGC
TGCACTGCGACGCGCACTACCCGGACATGCCTCCGCTCGTCTCCTTCATC
TCCAAGGTGAACCTGCCGTGCGTCAACCAGACCAACGGCAAGGTCGACCC
GGCCCGCCTCCCGTGCCTGAGCCGCTGGGACCGCAGCTACACGCTCGAGA
CGGTGCTCGCCGAGCTGCGCCGCGAGATGGCCTCGTCAGCCAACAAGAAG
CTCGCGCAGCCGCCCGAGGGCTCCACCTTCTGATCGTACACTCTCGCCAT
CGACCGCGCCGCGTCGCTTCTCCCGCTCTCGCTCGCTCAAATACAACGCG
TTGTGTA