Blastocladiella emersonii clone report

Clone ID BeCSAS2538
Best BLASTX Match ref|NP_172220.1|
Function Description unknown protein [Arabidopsis thaliana]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2538
GTCCGTGCTACGCAACCAACACCACGCAACCAAACCAACCACTACCACCA
TGTCGATGATTCGCCCCACTGGCTACTCGGGCCTCGAGCCGTTCGGCCTC
GAGCGCAACTTCCGCAGTACGCGTCCTGCCGCTGCCCTCGACCCGTACGG
CTACGGCGGCCACTCACGCTTCCACCACCATCCCCACCACCACTATCACC
ACCACCCTGCAGACATGATGGGCCAGCTCATGCAGGACTTTTTCGAGCCG
GGCACGCGCGGCGGCATGGGGATGGGCTCCTCGGCGCTCGACTTCCCGTC
GGTGCGCGCGGGCGGCGCGGGCGCGCTGTACGCGCCGCGGCTCGACATGC
GCGAGACGGACAAGGCGTTCGAGGTGAAGGCAGACCTGCCGGGGATCCCG
CGCGAGAACGTCAAGATCGAGGTGCGCGACGGCAACACGCTGGTGCTGTC
GGGCGAGACCAAGATGGACGCGGAGCGGCGCGAGGGGACGTGGCACGTGC
AGGAGCGGTCCATGGGCAAGTTCATGCGCGCCATCCCGCTGCCGCCCACG
GCTAACCTCGAGTCGGTCAAGGCCAAGTTCGACGCGGGCGTCCTGTGCAT
CGAGATCCCCAAGAAGGAGGAGGCGGCCACGTCGCGCAAGATCGAGATCC
AGTAGGCGTTTTGTGTGGGTCGGGGCCGTGGTGGGCCCCAGAGTGAGGAT
GTGGTTGTCTCAGAGTCGTCGTGCATGGTCGTGAAGTGTGAATGTAAAGA
GCTCGNTTTCCTC