Blastocladiella emersonii clone report

Clone ID BeCSAS2535
Best BLASTX Match gb|AAW45107.1|
Function Description nuclear transport factor 2 (ntf-2), putative [Cryptococcus neoformans var. neoformans JEC21]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2535
GGAACGAACCAACTACTACTAGCAAACATGGCGGCGGATCCCAAGGCGGT
CGCGAAGCAGTTCGTGGACTACTACTACCAGATCTTCGACACGAACCGTG
CCGGTCTGCGCCAGCTCTACCGGGAGCACTCGATGATGTCGTTCGAGGGC
ACCGACCTGCAGGGCGTCAACGCCATCATGAACAAGCTCGAGAACCTGCC
CTTTTCGCAGATCCAGCACCGCGTCCTGTCCGTCGACGCGCAGCCGTCCA
ACCCGACCGCCGGCTCGCTCCTCATCATCGTCACGGGCCAGCTGCTGACC
AACGGCGAGTCCCAGCCCCTGTTCTACTGCCAGACGTTCCAGCTGATCCC
CGAGAACAACTCCTTCTGGATCTACAACGACGTCTTCCGCCTCAACTACG
GTTAAGCGCGTCGCCGTCGTGCACGGTCGCGTCGATTCACGCCGTGGGTG
GGATGAATACACTGGTTTTCTGTTGCA