Blastocladiella emersonii clone report

Clone ID BeCSAS2534
Best BLASTX Match ref|XP_751914.1|
Function Description cytochrome c peroxidase [Aspergillus fumigatus Af293]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2534
GAACCATGTTCTCGCGCGCCTTCCTCCGCTCGCGCACCGCCGCCGCCCGC
GCGGCCCAGCGCGCCTCGGCCCCGACCGCCGCCGCCCGCCGTACCTTCGC
CGCCGAGGCCGGCGAGGCCGCCAAGGCCACGAGCAACAAGGCCCTCCCGC
TCGCCCTCGCCCTCGCCGCCGTCGGCGCCGGCGGCTACTACTGGTCGACC
ACCAAGTACGCCGACCTCGGCAAGCAGCTCGCCGAGAAGAAGGCCGCCGC
TGCGCCCAAGGAGCCCCTCGACTACAAGAAGGTCGCTGCCGACATTGCCG
ACCTGCTCGATGCCGACTACGAGGACGGCTCGTACGGCCCCATCCTCGTC
CGCCTCGCCTGGCACGCGTCCGGCACCTACGCCAAGGGCGAGGGTAACGG
CGGCAGCAACGGCGCCACCATGCGCTTCCACGCCGAGTCCTCGGACGGCG
CCAACAACGGCCTGAACATTGCCCGCGACCTGCTCGAGCCCATCAAGGCC
AAGTACCCCGAGATCTCGTACGCGGACCTGTGGACGCTCGCCGGCGTGGT
GGCCATCAAGGAGCTCGGCGGCCCCTCGATCCCGTGGCGCTCGGGCCGGT
CCGACGCCCCCGACGAGTCGGCGTGCCCGCCCCAGGGCCGTCTGCCCGAC
GCGTCCAAAGACCAGAAGCACGTCCGCG