Blastocladiella emersonii clone report

Clone ID BeCSAS2527
Best BLASTX Match emb|CAA17057.2|
Function Description rps30-2 [Schizosaccharomyces pombe]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2527
CGCGTCCGGTTGGAAATCTCAAAATGGGTAAGGTCCACGGTTCGCTCGCT
CGCGCTGGTAAGGTTAAGGGTCAGACCCCCAAGGTCGAGAAGCAGGCCGA
CAAGAAGAAGCCCAAGACCGGCCGCGCCAAGAAGCGCCTCATCTACATCC
GCCGCTTCGTCAACGCCCCCGTCATGTTCGGCGGCAAGCGCAAGATGAAC
CCCGCCCCCACCGAGAAGCCCTAAGCGTGCTCTTCCGCATCCGAAAAACG
TCGTTGCGGGCAGCTCGCCCTGTCTTCAAACATAAATCACGAGTATTTGT
ATTTGAAGCAACTGAACCCGTTTCCTTGTC