Blastocladiella emersonii clone report

Clone ID BeCSAS2525
Best BLASTX Match ref|XP_762590.1|
Function Description hypothetical protein UM06443.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2525
ATCAAGTCTAGACTTGGTGCATCCGCCTCCAAGTCCTTCGTCCTCTGCCA
AAACGACCGCTGCTGCGACCACCGCTCCCTTCCCCGCTACCACTATGGCT
GTCCGTAAGTATCGGTTGGCTGCCTCTTGATGATGCATGTGATGGATGAA
CCGAGACCCTGACGAAACCCCCGCTATTCCTCTCCCACAGGCGCTCAGTT
CGAGAACTCCAACGACATTGGCGTGTTTGCGCGCCTGACCAACTCGTACT
GCCTCGTATCGATTGGCGGGTCCGAGAACTTTTACTCGGTGTTCGAGGCC
GAGCTCGGCGACGTGATCCCCGTGGTGCACTGCTCGGTCGCCGGCACGCG
GATTGTGGGTCGCCTGACGGCGGGCAACCGCCACGGCCTGCTGCTGCCCA
ACACGACGACGGACCAGGAGCTGCAGCACCTGCGCAACTCGCTGCCCGAC
GCGGTGGCCGTGCAGCGCGTCGAGGAGCGGCTGTCGGCGCTGGGCAACGT
GATTGCGTGCAACGACTACGTGGCGCTGGTGCACCCGGACATTGACCGCG
AGACCGAGGAGCTGATCGCCGACGTGCTGCAGGTCGAGGTGTTCCGCCAC
ACGGTCGCCGACAACGTGCTGGTCGGCAGCTACGCGG