Blastocladiella emersonii clone report

Clone ID BeCSAS2524
Best BLASTX Match ref|XP_758624.1|
Function Description hypothetical protein UM02477.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2524
GCGTCCGGTGATAACTTCCTTGCTTACATTCTCCCCTGCCCACCACCCCC
TGCATTCGCCATGTACGCCGTCGCCCGGACCATCGCTCGCTCGACCAAGC
TGGCCATCGCCGCCCGCCCCGCCGCCCTCTCTGTGCGCTCGTACTCTGCC
CACTCGGACGAGAACCTGTCGTTCGACGAGTTCACCAAGAAGTACGTGAC
CTTCTTCGAGCAGGCCGAGGACCTGTTCGAGGTGCAGCGCGGCCTCAACA
ACGCCTTCTCGTACGACCTGGTGCCGTCGGTCGAGATCGTCGAGGCGGCC
CTCGCCGCGTGCCGCCGCGTCAACGACTACCCGACCGCCGTGCGCGTCTT
CGCCGGCCTCAAGGAGAAGTGCCCCTCCGACTCGCAGTACAAGCAGTACC
TCGAGGCCACCAAGTCGCTCCGCGAGCAGCTCGGCGTCGAGACCCGCGAG
GAGCTCGCCCTCTAAGCGTCGCTGTTTGTCGTCCTTCCCTCCCTCCCTTG
TCATTTCCCCACCACCACCACCACCGCTCTCGCCCGTCCCCGATGACCCT
TGTCGTATAGCGTCGGGGCGCGCGCGGGCTGCGCAATAAATTCAAAATCG
CCTCCTTACACACC