Blastocladiella emersonii clone report

Clone ID BeCSAS2523
Best BLASTX Match gb|EAA06390.1|
Function Description ENSANGP00000007334 [Anopheles gambiae str. PEST]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2523
CGACGAGAAGCCCACCGAGGACTACGGCGACATTGGCGGCCTCGACAAGC
AGATCGAGGAGCTCGTCGAGGCCATCGTGCTGCCCATGACCCACGCCGAC
CGCTTCAAGAACCTCGGCATCAAGCCGCCCAAGGGCGTCCTCATGTACGG
GCCTCCCGGGACCGGCAAGACACTGGCACGTCGTCGACCACGAGCGGGGA
GATTCCGGAGCAGTAACGCTAACAATCGATTTACTTTTAGCTGGCCCGCG
CGTGCGCTGCGCAGACCAACTCGTGCTACCTGAAGCTGGCGGGCCCGCAG
CTGGTGCAGATGTTCATCGGCGACGGCGCTAAGCTGGTGCGCGACGCGTT
TGCGCTGGCCAAGGAGAAGCAGCCCGCCATCATCTTCATTGACGAGATCG
ACGCGGTCGGCACCAAGCGCTTCAACTCGGAAAAGTCGGGCGACCGCGAG
GTGCAGCGCACCATGCTCGAGCTGCTCAACCAGCTCGACGGCTTCTCGTC
CGACGACCAGATCAAGGTGATTGCCGCCACCAACCGCATCGACATCCTCG
ACCCGGCGCTGCTGCGGTCGGGCCGCCTCGACCGCAAGATCGAGTTCCCG
CACCCGAACGAGGAGGCGCGCGCCCGCATCCTGCAGATCCACTCGCGCAA
GATGACCGTGTCCAAGGACGTCACTACGACGAGATGCCCGGTCATG