Blastocladiella emersonii clone report

Clone ID BeCSAS2522
Best BLASTX Match emb|CAA70948.1|
Function Description 19S regulatory cap region of 26S protease subunit 2 [Schizosaccharomyces pombe]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2522
CTGACGCCGTCGACCTGCTGCTCGAGCTCGAGGTCATTGACCGCATCGTG
CCGCACGTCGACGTCAACTCGTACACCCGCGTCGGCCTCTACATGGTCTC
GTGCGTCCCCTACCTCCCCTACCCCGAGGACGAGACGGTCCTGCGCGCCG
CCCACCAGATCTACCGCAACGTCAACAAGCTGCCCGAGGCCATCAACCTC
GCCATGCGCCTCGACGACAAGACGCTGATCCAGAACGATTTCGACGCGTG
CACCGACCCCGCCCTGCGCAAGCAGCTCGCCTTCCTCCTCGCCCGCCACG
CCGTGGCCGTCGAGACCAAGGACGAGACCGAGCAGGAGATCCTGTCCAAC
ACCAAGCTGTCCGAGTACTTCCTCAGCCTCGCGCGCGAGCTCGGCATCAT
GGACCCCAAGACCCCCGAGGACATCTACAAGACCCACCTCGAGACGCGCG
GGTCGTACGGCAGCATGGACAGCGCCAAGCTCAACCTGGCCTCCTCGCTC
GTCAACGCCTTTGTCAACGCGGGCTTCGGCAAGGACAAGCTCATGCTGGT
CGAGGACAACCAGTGGATCTACAAGAACAAGGACCACGCCATGCAGTCGG
CCACCGCCTCGCTCGGCATGCTGCTCCTGTGGGACGTGCAGCAGGGGCTC
ACCGAGATCGACAAGTACCTGTACAGCAACGAGGAGCACGTCAAGGCCGG
CGCCCTGCTCTCCATCGGCATCGTCTCGGCCAACGTCAAGGACGAGAACG
AGCCCGCCATGGCCCTCCTCTCGGAGCACCTGGGCGATGCCGGGTCGCTT
GCCACTCGCCTCGCGGCCATCTCGGGCCTCGGCATCGCGTACGCCGGGTC
GGCCCGTGCCGAGATTGTCGAGCTGCTGTCGCCGCTCGTGACCGACCAGA
GCGAGGTGAGCTGCACGGCGGCGCTCGCGCTCGGCATGGTGCAGGCCGGC
ACGTGCGACGGCGAGGTGACGTCGCAGATCCTGCAGGTGCTCATGGAGTC
CCCCGAGGCCAAGCCCAAGTCCAAGTTCATGGGGCTCGGGCTCGCGCTGC
TGTACCTCGGCAAGCAGGAGGCGTGCGAGGCGACGCTCGAGACGCTCAAG
GCCATCGAGTCGCCCGCGAGCAAGCCGTGGCAGGTGCTGGTCGAGGCGTG
CGCGTACGCGGGCACGGGCAACGTGCTCAAGGTGCAGGCCATGACGCGGC
TGTGCGGCGAGCAGTTCACCAACGACAAGGACCAGGAGGTGGCCGCCGAG
TGGCAGGCGTACGCGGTGCTCGGCATCAGCCTGATCGCCATGGGCGAGGA
CATTGGCGCCGAGATGACGCTGCGCACCTACAACCACCTCATGCACTACG
GCGCCC