Blastocladiella emersonii clone report

Clone ID BeCSAS2520
Best BLASTX Match ref|XP_628997.1|
Function Description hypothetical protein DDB0191996 [Dictyostelium discoideum]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2520
CCGCACCCGCTGCAACCTACCCGCCATCCCGCCCGCCGCGCCGATGCATC
ACGACGAGCTCGCGGACCCGGACGCGCCGTGCAACGCGCCGCGCGAGGAC
GTGCTGTCGATCCTGATCGCGACCGACAACCACCTCGGGTACGCGGAGAA
GGACCCGATCCGCGGCAACGACTCGATTGCGACGTTCGAGGAGATCCTCA
AGATCGCGCAGGACCGCGCCGTCGATATGGTGTTGCTTGGCGGGGACCTG
TTCCACGACAACAAGCCGTCGCGCAAGACGCTGTACTCGACCATGGAGCT
GCTCCGCGCGCACTGCATGGGTGACCGGCCCTGCGCGCTCGAGTTTTTGA
GCGACCAGTCGGTCAATTTTCCGAACCGGTTCGCGACGGTCAACTACATG
GACCCCAACTACAACGTGTCGATGCCTCTGTTCTCGATCCACGGCAACCA
CGACGATCCGTCTGGCGACGGCCTCGCGGCGCTCGACCTGCTCAGCGTGA
GCGGGCTGGTCAACTACTTTGGGCGTCAGCGCGAGGTGGACGACATCCTG
ATCACACCCGTGCTGCTGCGCAAGGGGATCACGTCGCTGGCGCTGTACGG
GCTGGGCAACGTGCGCGACGAGCGGCTGCACCGCACGTTCCTCAAGAAGA
AAGGTCAGATGCTGCGACCCATC