Blastocladiella emersonii clone report

Clone ID BeCSAS2518
Best BLASTX Match gb|AAH75123.1|
Function Description MGC81800 protein [Xenopus laevis]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2518
GGTCCCTGCAGTCCGGTCCGGAATTCCGGGTCGACCCCGCGTCCGCACGG
AACACCACCGTCTGCAACGTATCTGTCAACCAAGAAGCAACCACCATGTC
GACCGCCATCACCCTCCCCGCCGACTACGGCTATGTGATCCTGGCCCTCG
CCGGTACTTGAGCTCTCCCCTGTTCCCCGAGGAGCTCTTGCAGTCGAAAC
ATGACTGACGCAGGTTCCTGTGGTCGGTAGCCATCGCGTTCCACTACCAG
TTCGCGTCGCGCTACATCCCGGGCCTCCGCAAGGAGCTCAAGATCGAGTA
CCCCGACATGGGCTGCGGCATCTACGCCAAGAAGCTCTCCGACAAGGACT
GGGTGCGCTTTGGGAATGCGCAGCGAGTCCACCAGAACTACCTCGAGCAG
CTGCCCAACACGCTGCTGTTCACGGCCTTCTCGGGCCTGTTCCAGCCCAA
GGTCACGGCTGGCCTCGCCGTGTCGTACATCATCGGCCGCGAGATCTATA
CCCAGGGCTACTTCAAGAGCGGCCCTCGCTCCCGCCTGTACGGCGCCCCG
TTCATCTACACGGGGTACCTCGGCATGTTCGGAATCATGGTTTGGGGCGC
CGCCAAGTCGGTCGGCCTCTTCTGAGCGCGCCGTCGCCGACTCGCGCGTG
TCGCGCGGTTCTGCGATTGTGAGCGAGCGGCTGCGGCTGCGAGTTTTGTC
GATTGACCATTGATATAACCGAATGCTAGTC