Blastocladiella emersonii clone report

Clone ID BeCSAS2512
Best BLASTX Match gb|EAS36643.1|
Function Description hypothetical protein CIMG_01997 [Coccidioides immitis RS]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2512
CGGCTCTCTGCAACGCATCAACCACCGTAAAGCCATGTCATCCGACTCGC
TCGCCAACTCAACCCTCTTCGACGTCAAGGGCAAGGTGGTCCTCGTGACG
GGCGGGTCGCGCGGCATCGGGCTCATGATCTCGGCCGGGTTCGTGCAGAA
CGGTGCCACCGTGTACGTGACGGCGCGGTCCGCCAAGGTGAACGAGGCCG
TGGCCGCCGAGCTGACCAAGCGCGGGCCCGGGTCCTGCCACGCCATCACG
GGCGACCTGCAATCGCTCGACGACATCAAGCGGCTCGTCGCCGAGATCGA
GGCGCGCGAGGGCAAGCTCGACGTGCTCGTGAACAACGCCGGCGCCAACT
GGGGCGCGCCCGTCGAGGAGTACCCCGACGCCGCCTTCGAGAAGGTCATG
ACGCTCAACGTCCGCCGCGTCTTCACCCTGACGCAGGCGTGCCTGCCGCT
GCTCCTCAAGGCCGGCACCGACGCCGACCCGGCGCGCGTCATCAACATCG
GGTCCGTCGACGGGATCCGCGTCCCGAACCTCGAGACCTACGCGTACTCG
GCGTCCAAGGCCGCGCTGCACCACCTCACGCGCGTCATGGCGGGGCAGTT
CCCGACCCGCGGGCCCGTCACCGTCAACGCCGTCGCCCCCGGCCCGTTCG
AGTCCAAGATGATGAAGGCCACCCTCGACAAGTTCCACGACGCGATCGTC
GCCGGGATCCCGCTCGGCCGCATCGGGCACCCCGCCGACATGGCCGGCGT
CTGCATCTACCTCGCGTCCAAGGCCGGCGCGTACGTCTCCGGCGCCGTTA
TCCCCGTCGACGGTGGCGCGCTCGTGCGCGCGTCGCTTTGAATGAGCGCG
TGTAATCGCGCTTAGGTTGGGAATATACGAAGCGGTTCTGT