Blastocladiella emersonii clone report

Clone ID BeCSAS2511
Best BLASTX Match ref|XP_386338.1|
Function Description hypothetical protein FG06162.1 [Gibberella zeae PH-1]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2511
AACGCATCAACAACAAACCGTAACCATGCGCATCACGCTCGCCACCGACG
CCGGCGACCTGCACACGGTCGAGGTCGGCCCGTCCATGACCGTGGCCGAT
CTCGCTGCGCTCGCCGCGTCCTCGTTCCGCACCATGCAGGCCGCCGGCAC
CGCGCGCCTGTTCCTCAACGGCCAGGAGCTCACGGTCCCGACCGCGTCGC
TGTCGCAGGCCGGAATCATTGCCGACGAGGTGCTGGTCGTGCGCCCCGCC
GCGGGAGCTGCCATTGCGCGCCCGGCTGCTGGCGGTCGCCCCATGGCGCC
GGGCGGGATCCCGACCAACCTGACGCCGGCGCAGATGCAGGCGGCCATGG
GCCAGTTCCTGGCGCAGATGCAGCAGCAGATGATGGCGGGCAACCCGGAC
CTGCAGGCGCAGCTCGAGCGGCAGCGCGCCGAGCAGGACAAGCAACGCAA
GATCGACGAGAACCTCGCCCTGGCCATGGAGCACACGCCCGAGGCGTTCG
GCCAGGTCATCATGCTGTACATTGACGGCAAGGTCAACGGCCACCCGCTC
AAGCTGTTTGTCGACTCGGGCGCGCAGTCCACCATCATGTCCAAGCCCAT
GGCCGAGGCGTGCGGGCTCGCCGACCTCATCGACACGCGCTTCGCCGGCA
CCGCGGTGGGTGTCGGGTC