Blastocladiella emersonii clone report

Clone ID BeCSAS2510
Best BLASTX Match ref|XP_755263.1|
Function Description antigenic mitochondrial protein HSP60 [Aspergillus fumigatus Af293]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2510
CGCCACCTCGATCCGTTCGCCACTGTCAACCATGCACCGCATTCCCCACG
CTGCCCGCGTCGCCCGCGCCGCCGCCCTGCGCCGGTCCTTCTCCACGCAC
AAGGAGATCACGTTCGGCGCCGACGGCCGCGCCAAGCTCGCCAAGGGCGT
CGACACGCTGGCCCGCGCCGTCGCCGTGACGCTCGGCCCCAAGGGCCGCA
ACGTGCTCATCGAGCAGCCCTACGGCTCGCCCAAGATCACCAAGGACGGT
GTCTCGGTCGCCAAGGCCATCACGCTCGAGGACAAGTTCGAGAACCTCGG
TGCCCGGTTCGTGCTGCTTTCCCCGACTCTGATCGATCGGCTCCGACTAA
TCCGCGCCCACGCACATCCATGTAGCCTCGTCCAGGACGTCGCCAACAAG
ACCAACGAGGTCGCCGGTGACGGCACCACGACCGCCACGGTCCTCACCCG
CGCCATCTTCAACGAGGGCCTCAAGAACGTTGCCGCCGGGTGCAACCCCA
CGGACCTGCGCCGCGGTGTCCAGGTGGCCGTCGACGCCGTCGTCAAGCAC
CTCAAGGAGAACCGCCGCATGATCACGTCGTCCGAGGAGGTGGCCCAGGT
CGCGACCATTTCGGCTCACGGCGACCGCCACGTCGGCGCCCTGATCGCGC
AGGCCAT