Blastocladiella emersonii clone report

Clone ID BeCSAS2509
Best BLASTX Match ref|YP_214255.1|
Function Description phage tail fiber-like protein [Cyanophage P-SSM2]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2509
CTCGCTCAACCTCGCCCACCACCAAGATGACTCTCTGCACCCCGGTCCAC
ATCCCCGCCGTCCAGGCCCAGTCGCAGTCGCAGTCGCAGTCGCAGATGCA
GTTCGGCGGCCACGGCGCCCAGCTGCAGTCGCAGTCGCAGTCCCAGTCGC
AGTTCCAGGGCCACCACTCGGTCGACCAGGCCCAGTCGCAGATGCAGTCG
CAGTTCGGCCACGGCTTGGGCGCGCAGCAGCAGTCGCAGGCCCAGACCCA
GTGGGGCAACCACCACGGCGACGTCGCGCAGCACCAGTCGCAGTCGCAGG
GCCAGTGGTCTAACGGCCACGGCGATGCTTTCCAGTCGCAGTCGCAGTTC
CAGCAGGGCCACAACTCGTTCGACGGCTTCGTCGGTGGTAACCCGAACAC
GTGGGGTCCCGCGGGCGACCATGGCCCGATTGGCGGCAACCCGAACACGT
GGGGTCCCTCGAGCGACCACGGTCCGATCGGCGGCAACCAGAACACGTGG
GGTCCCTCTGGCGAGCATGGCCCTATTGGCGGCGACCCGGCCACCTGGGG
CCCCTTCGACCCTATTGGCGGCAACCCCAACACTTGGTCGCACGACACTC
ACTTCACGACCTTCTTCTAAAACCGCTAAGACGTCGCGCGGGGTTGGTCC
AACAAACTCGGACGGATCGGCCGTTTGTGTATCGCATCTAGCTCTAATCA
CATCTCTTCATTC