Blastocladiella emersonii clone report

Clone ID BeCSAS2507
Best BLASTX Match ref|YP_577603.1|
Function Description beta-ketoacyl synthase [Nitrobacter hamburgensis X14]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2507
GTCCCGCCATGACGACCATCACCCTCCGCAAAGTCGCCGTCACAGGCATC
GGCCTCGTCACGCCGCTCGGCGTCACGGCCTCCTCGACGTGGCAGCGTCT
GACCGCCGCCGAGTCCGGGCTCGTCGACCTGCGCACCTCGCCGCACGGCC
TGCGCGGCGCCGACTTTGCTTCGCTTCCGTGCACCGTCGCGGGCGTCGTC
CCGCGCGCCGACCTCGACCCCGCCTCGTTCCTCGCGCCGGGCGACGACCG
CAAGACGTCGCTGTTCATCCAGTACGCGCTGCGCGCCGCGCGCGAGGCGC
TCGCCGACGCGGCGTGGCGGCCCGACACGGATGCCGACTGCGCCGCGACA
GGTGTCGCGATCGGGTCCGGGATCGGCGGCGTCGACGAGTTTGCCGCCGC
GGACCGCGCGGTTGCGAGCGGCGCGCTGCGTAAGGTGTCGCCGTTCGCGG
TCCCCAAGGCCCTCGTCAATATGGCCGCCGGGTGGGTCTCGCTCACCCAC
GGGTTCACCGGACCCAATCTGTGCTCGGGCGCGGCGTGTGCGGCGGGCGC
ACACTCGATCGCGGACGCGGCGCGAATCATTGCCACGGGCGAGGCGAAGG
TCATGGTTGCGGGA