Blastocladiella emersonii clone report

Clone ID BeCSAS2503
Best BLASTX Match ref|XP_449326.1|
Function Description unnamed protein product [Candida glabrata]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2503
CGGGTCGACCACGCGTCCGCACCTTCCTTGATGCAATGTATACGCTAGTC
TCGGGCCTGTACAAGCTGTGGACGCGGCGGGAACAGTACTCGGTGATCAT
CCTCGGGCTCGACAATGCGGGCAAGACCACGCTGCTCGAGCGTATCAAGC
ACATCTTCACGGGCGTCATGGCCATGTCGCCCGAGAAGATTGCGCCGACG
ATCGGCCTGAACAGTGCGTGTCGGGTTGTGTGAGACTGGGTCAAGGAGAC
TGACACTCGTCTGGAAAGTCGGCAAGATCGCCATGGACAAGGTCAACGTC
AACTTCTGGGACCTCGGCGGCCAGCAGGAGCTGCACAGCATCTGGGAAAA
GTACTACTCGGAAGCCCACGCCGTCATCTTCGTCGTCGACTCGACGGACG
TCGCGCGGCTCGAGGCGGTCAAGGCAACGTTCGACAAGATGATCACCAAC
GACGCGCTCGAGGGCCTGCCCGTGCTGATGCTCGCCAACAAGCAGGACCT
GCCGGGCGCGATGCGCGTCGAGCAGATCAAGGAGATCTTCAACCACATTG
CGCTGCAGATGGGCGCGCGCGACTCAAAAGTGCTCCCCTGCGTCGCGCTG
ACGGGTTCGGGCGTCCGCGACGCCGTCGACTGGCTGTTCGTCCGCATCCA
GCACAACCGCGCCGGCAGGCCGCCCGTCTACCGCAACTGAAGGATAGCTG
TATATATATGAACTAACCGTACGTC