Blastocladiella emersonii clone report

Clone ID BeCSAS2502
Best BLASTX Match ref|XP_662119.1|
Function Description hypothetical protein AN4515.2 [Aspergillus nidulans FGSC A4]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2502
TCCGGGTCGACCACGCGTCCGCACGGAAACCCATGTATTGAGCAGCCCGG
GACGGCTCCTACCTGCTGCACTACCGGCCTAGCCAAACCATAAAACAGGC
CAAACCATGCGAGGCTCCCGACATGTCCCCGCGACGCTGCTGCTCGCCGT
GGCCGCTCTCGTCGCAGCTTCGCTGCTCGCTGGTGTGACGGCCCAGTCGA
CCAACTGCCCCAAGGTCGGCAAGCCCTGCACCGCCTCCTTCCCCTTCTGC
AACCGTGATGGGCGGTGCACCAGCATGCTCTGGGACGGCTACATTGACAA
CGGCTGTCAGCAGAACGCCTCGTACCAAAACGCCTGTGTGGGCCGCCCGC
GGTGCAAGTCGACCCGGATCGAGTTCGACAACCAGAACCAGGTGCCGCGC
CGCGACAAGTACCTGGGCAACCCCGACGAGCAGCCCTTCATCGACGAGAT
CGGCAACACCGAGGTCAAGGACGGCAACCTCATTCTCAAGATGCGCTACA
ACAAGGAGCTCAAGGCAGGGCAGCTGACTCGTGTTACCAGCTCTCGCTGG
GTCCACTACGGGACCTACTCGGCCCGCGTCCGCATGTCGAGTGGCAAGGG
CTTCGTCTACACCTGGATCTTCAAGTCGAACGCGGACCGCGACGACACGG
GCGACGAGATCGACTTTGAGTGGCTCCCCGGCAGAGCAACCAGCAGACGC
AGTCCAACTGGTTCTACAACGGGACCATCGACTACACCAAGGGAGCCATC
CACGACATGGACTCTTCCCTCGATGTCTGGCACACGTACACGATGAACTA
CGCTCCGGGTAAGCTCGAGTGGCTCATCGACGACAAGGTCGTGCGGACCG
TTCTCAAGAACGCCACCCTCAACACCCCGTTCCAGGAGGGCCGCCTCTTT
GCCTCGATCTGGGACACGTGCGGGAACGGCATCGAGCGCGGTACGCAGGA
ATGGGCGGGCGGTCCGTCGCAGTGGTGCGGCAACGCGCCTGACACCAACC
CCGAGTACCGCATGCTCATCGACTGGATCGACATCAAGTGCGCCGAGGGC
TACGAGGACTNTGCCCCCCTCGCTGTCCCCAGGTCACAGCCCCCGCTGCC
TCGGCTCCCTCCATCAACGCGGGCCAGTCGAAGTGGACCACGGCCATCGC
GGCAACGATGCTCATCGTCGTCGCCGCGACCACGGCCGCTCTCGGCTTCT
AAAGCCCCTCCTTTGTGATTTCTTCCGTGATGTATTGTCGACGTCTCCAT
CACACCCGCTTCTCAAATAGAACATCCGTGCGAGGTTTTCTCC