Blastocladiella emersonii clone report

Clone ID BeCSAS2500
Best BLASTX Match gb|EAQ93251.1|
Function Description hypothetical protein CHGG_01486 [Chaetomium globosum CBS 148.51]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2500
TTCGACGACTTTGAGCCCTCGGTCCTCGCCCCCAAGGAGATTGACGACCC
GACCGACTCCAAGCCCGCCGACTGGGTCGACATCGCCATGATCCCCGACC
CCGAGGCCACCAAGCCCGAGGACTGGGACGAGGACGCGCCGCTCGAGATC
CCCGACGCCAAGGCCACCAAGCCCGCCGACTGGCTCGACAACGAGCCCGA
GTACGTGCCCGACCCGGAGGCGGCCAAGCCCGAGGACTGGGACGACGAGG
AGGACGGCGAGTGGACCGCGCCCACGGTCGCCAACCCCAAGTGCGCCGCT
GTGTCTGGCTGCGGCGAGTGGACCCGCCCCACGATCCGCAACCCCGACTA
CAAGGGCAAGTGGACCGCCCCGCTCATCGACAATCCTGCCTACAAGGGCG
TGTGGGCCCCGCGCAAGATCGCCAACCCCGAGTTTGTCGACGAGAAGCAC
CCCGGCCACATGACCCCGATCGGCGCTGTCGGCCTCGAGCTGTGGACCAT
GCAGGACCAGATCCTCTTCGACAACATCCTCGTCTCCGACTCGGTCACCC
CCGCCCAGCTCGACGCCTGGACCAAGGACACGTGGGTGCCCAAGAACGCG
GCCGAGAAGGAGATTGCCAAGGTCGAGGAGCCCGACACCAAGCTCGACGA
CGCGGCCGACCTGACCAAGGACGCCGCCGCCAGCAAGGCGCCCATCGCGT
GGAAGGACCAGCTCAAGCCCGAGAACCTCCAGGTGTTCGCCACCCAGGTC
CTCGTCGACCCCATTGCCGCCGCCAAGCGCTTCCCCGTCGTCGCCGGCGG
GCTCGGCGCCGCCATCGCCCTCTTCGTCACGCTGCTCGTCACGTCCATCT
TCGGCTCGGCGTCGTCGTCGGCCGAGAACGAGATCGAGGAGCTCGAGGGC
GAGGAGGAGGAGGACGAGGACGAGACCGAGGAGGCCACCGAGGAGGTCAA
GGCGTCCAAGAAGTCGTCCAAGCCGTCGC