Blastocladiella emersonii clone report

Clone ID BeCSAS2499
Best BLASTX Match ref|XP_756659.1|
Function Description hypothetical protein UM00512.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2499
CACCGCCACCCGCTGCAACGTATTCGCATGATGATGATGATCCGCACCGC
TGCCGCGCGCCGCGCTTATACGACCGGCACCGCCGCCGCCGCCTCGCAGT
CCGCGTCCGCGTCCAAGGCCGTGACCAAGGTCGAGCCCATCGAGCAGACC
GACGTCGCCGTCGCGTCGGGCGCCCCCGAGCTCATGCGCCAGCGCGCCGT
CCGCATCTTCCGCCCCGCCAAGACCGCCATGCAGAGCGGCAACGACAACA
CCCGCTTCTGGAAGCTCGAGTGGAACAACGAGGACCGCTGGACCAACCCG
CTCATGGGCTGGGCCTCGTCGGCTGACTACCAGCAGGCGACCTTCCTCAA
GTTCCGTACCGAGGAGGAGGCCGTGCGCTTCGCCGAGCGCCAGGGCTACC
AGTACGAGGTGGTTGCGCCGCCCGAGCCCAAGTTCGTCGTCAAGTCGTAC
GCGACCAACTTCCACTACAAGACCGGCAAGCTCCGCTTCCACCACACCAA
GTAAGTCAGCCGGACTGGCGGCAACCTCGGCCGCCGCCACCGCTCTCTCG
CTTACCTTCCATCACCCCATCCCTACCCCCCTACCTTTGTTGATACATTT
GCCCTCGTCCGTC