Blastocladiella emersonii clone report

Clone ID BeCSAS2498
Best BLASTX Match ref|XP_760336.1|
Function Description hypothetical protein UM04189.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2498
CGCAACACCATGGAATCGACCGTGAGCGCCTCGGCGCACGCCCTCGCGCA
CCACGCCGCCGACTCGCTGCTCGCCGTGCTCAATCACCTGCGCGCCGCGT
CGCCGCTGCGCCTCCTCGCAGTCCTCGGCTCCGTGGCCTTCCTTGCCAAG
ACCACCTCGCTCGCCTGGTCCATTGCCGCGCGCACTCGCGCCAACCGCGC
CCTCGCCCTCGACGGCCAGCCGCTCCCCTCGCCGCCCGCGACGCTGCTGC
AGCGCTGGCTGTGGGGCCACGCCACGAGCTTCCGCGAGTTCCCGTCCATC
GTCGCGTGGCACCGCCACCACACGCGCACGCTCGGCCGCGTCTACATGAC
CCGCGCCCTGCTCGGCGGGCGCAACGTCACCGTGACCGACCCCAAGGCCC
TGCACACGATCCTGTCCGCGCGGTCGTACGCGTTCGGCAAGACGAGCGAC
GCGCGCCGGTTCATTGCCCAGATCACGGGCGATATGGGCCTCCTCGTCAT
TGACGGCGACGTCCACAAGCGCCACCGCCGGCTCATGAACCCCGTCTTCA
ACCTGTCCACGCTCAAGCGGCTCGTCCCGACCATGGTCGACAGCGTCGAG
GAGCTCGTGCGCCTGCTCGATGCGCGGGTCGGGGA