Blastocladiella emersonii clone report

Clone ID BeCSAS2497
Best BLASTX Match ref|XP_755486.1|
Function Description ketoreductase [Aspergillus fumigatus Af293]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2497
CGGGTCGACCCGCGTCCGGAACGGCCCGCTGCAACGTATCACCATGCTCT
TCAGCGACTACGAGTGCATCTCGTCCTTTGTGGCCGCCGTGGCCGCGGCG
CCCGTGTCGCTGCTCGTGCTCGGCGCGCTCGGCTCGCTCGTCGTCCTCAA
GTACACGTTCAGCCTGCTTGGCCTCGCCTACAACCTGACGCTGCGCCGCG
GGATCAGCCTCAAGAAGTTTGGCGCCGGCACTGGTGCCTGGGCCATCATC
ACTGGCGCGTCGGACGGGATCGGCAAGGAGTTTGCGACGCAGCTGGCCAA
GGCCAAGTTCAACGTGGTGCTCATGGCGCGCACCGAGTCCAAGCTGCAGA
ACCTGGCGGGCGAGATCCGCGAGGCGCACGGCGTCGAGACCAAGGTGATC
CCGTTCGACTTTTCGACCACGGACTCGGCCGCGTACCAGCAGGTCGCCGC
CCAGGTCGCTGGCCTCAACGTGACTGTCCTGATCAACAACGTCGGCACCA
ACCACGCGTTCCCGGTCCCGTTCCTCGAGGAGGAGGATGCCGTCATTGAC
CGCATCGTCGACGTCAACATCTCGTCCATCATGAAGCTCACCAAGGTGAT
TGCCCCCAAGCTCGTTGCCCAGAAGAAGGGTCTGATCCTCAACGTCGGCT
CGTTCGCTGGGATCCTGCCGCAGCCGCTGCTGTCCGTGTACTCTGCGTCC
AAGGCGTACCTGCTGACGTGGTCGCAGGCGCTGGGCAAGGAGCTGGAGCC
GCACGGCGTGCACGTGCAGTGCCTGTCGACGTACTTTGTGGTGTCGGCCA
TGTCCAAGATCCGCAAGCCGACGGCGGCGATCCCGACGGCCAAGGCGTAC
GTGGCCAAGGTGCTCGGNCACATTGGCAACCCGGGCGGCGCCCCCACGCC
TTCACGTCGACCCCTA