Blastocladiella emersonii clone report

Clone ID BeCSAS2495
Best BLASTX Match gb|AAH75454.1|
Function Description Nucleoside phosphorylase [Xenopus tropicalis]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2495
CTCTACTTGCACTCCCCATTTTGCAACCCACCGCAACAATTACACCATCA
CCATGGCCGGCCACACCGTGATCCCGCTCGAGCAGTACCACTCGGCGCGC
GACTACCTGCGCTCGTGCCTGCCCGCCAACACCACCCCGACGGTCGGCGT
CGTGTGCGGCTCGGGCCTCGGCAAGCTGGTCTTTGGCCACCTCGGAAACC
AGTATGTCGTGTGCATGGTTGGCCGGTTCCACCCGTACGAGGGCTACTCG
CCGCAGCAGGTGACGTTCCCGATCCGCGTCATGACCCTGCTCGGCATCCG
CCTGCTCATCGTCACCAACGCCGCCGGCGGCCTCAACGAGTCGTACTCGG
TCGGCGACCTCATGGTCTTCGAGGACTTTGTCGGGCTCTTCCACCCGGGC
GCCACCAGCAACCCGCTCATCGGCTCCAACGAGCCGTCGTTCGGCCCGCG
CTTCCCGCCGACCTCGGACGCGTTCCCCAAGCCCGTGCGCGCCCACGCGT
TCCGCACCGCCCACAAGCTCGGCTTCCTGAACAAGGTGCACTCGGGCATC
TACTGCTTCGTGTCGGGCCCGCAGTACGAGACGCGCGCCGAGTGCCGTCT
CCTGCGCAGTGCTGGCGGCGACGCGGTCGGCATGTC