Blastocladiella emersonii clone report

Clone ID BeCSAS2494
Best BLASTX Match gb|AAW46319.1|
Function Description conserved hypothetical protein [Cryptococcus neoformans var. neoformans JEC21]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2494
CCTGCAGTCCGGTCCGGAATTCCGGGTCGACCCCGCGTCCGCCATCTGCA
ACGAAACGTAACTACATGCAACCATGCCGCACAGCGTCACCCTCCTCGTC
TACGACCTCTCCCAAGGCATGGCGCGCATGATCTCGCGCCAGCTGACGGG
ACGGCAGATCGACGGCATCTGGTGCGCCCTTACGCCCGTCTCTTCGCCGC
CGCCACACGCTGAACCAGTTCCTGAAACAGGCACACGTCGGTCGTGATCC
ACGGGCAGGAGTGGTACTTTGGCCAGGGCGTGTTCAGCACGACGCCAGGC
GTGCACCACTACGGCGCGCCCGTCCAGCGCGTGCCCATGGGCGAGACGGA
GATCTCGCGCGAGCTGTTCCGCGAGTTTATCGACGAGATCCGGCCGCGGT
TCACGGCCGTCCACTACCACCTGCTCAACCACAACTGCAACACCTTCTCG
AACGAGGTGTGCCAGTTCCTAGTCGGCCGGTCCATCCCGTCGTACATCAC
CAACCTGCCCGGCGACTTTCTTGAGACCCCGTTCGGCCAGGCCCTGCGCC
CCGTCATCGACTCGTTCTTCAGCTCGCCGCACGCTCAGCCGGTCCGTGCC
CCTCCTGCCACCACGACCGCTCCTGCTCCTGCGCGCGTCGCCGTCCCGGC
AGCTGGGCCGCCCGGGCACCCGCACGTCGCGCTGTCGCTCCCCGAGCTGC
GCGCCATCTTCGACCAGCCGCACTGGCACTCGGCGTCGTCGCCCAAGATG
TGGGAGAAGCTCGAGTCCGTGCTGGACCACACGCTGACCAACGTCGACCC
GA