Blastocladiella emersonii clone report

Clone ID BeCSAS2491
Best BLASTX Match emb|CAE51055.1|
Function Description novel protein similar to mouse and human membrane bound C2 domain containing protein (MBC2) [Danio rerio]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2491
CCCGCTACGAATCAACACCCACGTAACACCATGTCCCAGGTTGACGCCAT
CGAGATCACCGTTGTCGAGGCCCGCCACCTCGACGGCGAGGACGGCATCC
TCGGCCGCAAGTCGGACCCGTACGTCATCGTCCACGCCGGCATGACCCAC
AAGCACAAGACGGCCGTCCAGCACAAGACCGTCAACCCCGTCTGGAACGA
GAAGTTCGTCCTCACCAAGGGCACCTTCTCTAACAAGATCCACGTCGAGA
TCTATGATGAGGATTTTGGGCCCGATGACAAGCTCGGGTTCCTCGAGATC
AACGTCGAGGACGTTGTGCGCAACGGGCACCTCGACATGTGGTACCCGCT
GACCAACAAGTCGGGCAAGAAGGTCGCCAAGGGCGAGATCCACCTCATCC
TGCGCCCCGTCTCGCGCATGTAAGCTGCGCGAGCGCAGAACGAGCGGTTG
TGGCCGTGCTAAGCCGCGGAGCGTGTGAGTTGTACAGTAATATCACAGGG
TTTCTCTCCCTG