Blastocladiella emersonii clone report

Clone ID BeCSAS2490
Best BLASTX Match ref|XP_716758.1|
Function Description putative histone acetyltransferase component Tra1p fragment [Candida albicans SC5314]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2490
GCGTCCGCGGGCCTGTGGCGGCGGCGGTGCCAGTACCCCGAGACCAACGC
GGCGCTGTCGTTCCAGCAGGTCGGCCTGTGGGAGCGCGCGCAGCAAATGT
ACGAGCAGGCGCAGTCCAAGGGCCGCACGGGCACGCTCGGCTTCTCCGAG
TCCGAGTACTCGCTGTGGGAGGAGCAGTGGGTCCGGTGCTGCCAGAAGCT
CCAGCAGTGGGACGTGCTCGAGGACGTGGGCAAGCACGAGGACAACTGCG
AGGTGACGCTCGAGGCCATCTGGCGGCTCGGCGACTGGACCGGTAACGGG
AAAGAAAAGGGCGAGACCGAGGCCATGCTCCAGCGCATCAACCAGTCGCC
GCGGTCCAAGGTGTTCCAGGCCTTCGTCGCACTCAACAAGCTCGCGGAGC
GCAAGGAGCTCGGCGACAAGGCGCGCGTGCAGGAGTTCCAGGCCATCTGC
GACGAGGGCGTGCAGATGGCGCTGCGGACGTGGCACCAGCTCCCGCACGC
CGTCAGCGACTGCCACATCCCGCTGTTCGGCACGTTCCAGCAGTTTGTCG
AGCTCGGCGAGGCGCTGCAGATCTACACGTCGCTGAGCCAGACGGGCCCG
GGCAACTACGAGGCCAAGGCCAACGAGCAGAAGTCGATGCTCGCGACGTG
GCGC