Blastocladiella emersonii clone report

Clone ID BeCSAS2489
Best BLASTX Match ref|ZP_00766232.1|
Function Description Aldo/keto reductase [Chloroflexus aurantiacus J-10-fl]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2489
CTCTTCCTGTCGATAAAAGCCGGCTGCTCCCCTCCTTTCTTTCGTCCAAC
ACAAACCAACACATCCACGAAGCAAACCAACCGAACCATGTCGACCGCTG
CCGCCACCTCGACCGAGCGCCCGAACGCGCACAAGATGCACTACGCGCGG
CTCGGCAAGTCGGGCCTGCAGGTCTCTCGCATCTGCGTCGGCATGATGTC
GTACGGGTCGCCCGAGTGGCAGCCGTGGGTGCTCGACGCCGACAAGTCGC
TGCCGCTGCTCAAGGCCGCGTGGGACGCCGGGATCAACTTCTTCGACACG
GCCGACGTATACTCGAACGGCGTGTCCGAAACTTTGCTCCGGGACTTCAT
GCGCAAGTACGGCATCAAGCGCAACGAGATTGTAGTTGCAACCAAGGTCA
ACTTCCAGATCAGCGACACGCCTGGCGCCCAGGACGCCTTCGCGCCGCTG
CCCGCGTACGCCATGGCCAACAAGCGCGGGCTGTCGCGCAAGTACATTTT
CGAGGCGGTCGAAGCGTCGCTCGCGCGCCTCGGCACCGACTACGTTGACC
TGTACCAGATCCACCGCTGGGACAGCAACACGCCCATCGAGGAGACCATG
GAGGCGCTGCACGACCTGGTCAAGGCCGGCAAGGTGCGGTACATTGGCGC
CTCGTCCATGTACGCGTGGCAGTTCGCCAAGGCGCAGGCCGTCGCCGAGC
GCCGCGGGTGGACCAAGTTCGTCAGCATGCAGAACCTCGTCAACCTGGCG
TACCGCGAGGAGGAGCGCGAGATGCTGCCGCTGTGCCGCGACCTCGGCGT
CGGCGTGATCCCGTGGTCGCCGCTCGCCGGCGGCCTGCTCTCGGACAAGG
GCAAGTCGGCCACCTCGCTGCGCGCACAAACCGACTCGTTCCGCAGCATG
CACGTCACCGAGTCGTCGGCCG