Blastocladiella emersonii clone report

Clone ID BeCSAS2487
Best BLASTX Match gb|AAD41900.1|
Function Description gamma-tubulin [Schizosaccharomyces japonicus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2487
ATTCTCTCGCGGCTCCGACTGCCTGCAACCGAAAAGTCCCTCTTCCATGT
ATCACACTTGACGCAACCACCATGCCACGCGAATTGATCACCCTGCAGGC
CGGCCAGTGCGGCAACCAGATCGGCCACGAGTTCTGGAAACTGCTGTGCG
CCGAGCACGGCATCTCGCCCGACGGGATCCTCGAGGACTTTGCGACCGAG
GGCGGCGACCGCAAGGACGTCTTCTTCTACCAGGCCGACGACGACCACTA
CATCCCGCGCGCGCTGCTGCTCGACCTCGAGCCGCGCGTCATCAAAAACA
TCATGCAGTCGCCCTACGCCAACCTCTACAACCCCGAGAACCTGTTCCAC
ACCAAGAGCGACGGCGGCGGTGCGGGCAACAACTGGGCGCAGGGCCACTA
CCACACCGAGAGCCTGTTCGAGGACATCATCGAGATGATCGACCGCGAGG
CCGACGGGTCCGACTCGCTCGAGGGGTTCATGCTGCTGCACTCGATCGCC
GGCGGCACCGGGTCGGGCATGGGGTCGAACCTGCTCGAGAAGCTCAGCGA
CCGCTTCCCCAAGAAGCTCGTCCAGACGTACAGCGTGTTCCCGAGCCACA
GCGAGAACAGCGACGTGGTCGTGCAGCCGTACAACGCCATCCTGACCCTC
AAGCGCCTCACGCTGTACGCCGACTCGGTCGTCGTCCTCGACAACGACGC
GCTCGACCGCATCGCCACCGACATGCTGCGTGAGCAGAACGCCAACTTTA
CCCAGTCCAACCAGATCGTGTCCACGGTCATGTCCGCGAGCACCGCCACG
CTGCGGTACCCGGGCTACATGAACAACGACCTCGTCAGCCTCGTCGCCTC
GCTCATCCCGACGCCGCGGTGCCACTTCCTGTCCACGTCGTACACGCCGT
TCGCCGCCGAGGTTGTCGACAACGCCAAGACGGTGCGCAAGACCACGGTG
CTCGATGTCATGCGCCGCCTGCTGCAGCAAAAGAACCGCATGGTGTCGAC
CAAGGACTCCAAGAAGTCGTGCTACATCTCGGCCCTCACCATCATCCAGG
GCGAGGCCGACCCGACCGAGGTCCACAAGTCGCTCCTGCGCATCCGCGAG
CGCCGCCTCGCCCAGTTCATCCCGTGGGGCCCCGCCAGCATGCAGGTCGC
CCTGTCCAAGAAGTCGCCCTACATTCAGAGCAGCCACCGCGTCTCCGGCC
TCATGCTCGCCAACCACACGGCCGTTGCTGGGATGTTCAAGAAGATCACG
GTGCAGTACGACAAGATCCGCAAGCGCAACGCCTTCCTGCAAGAGTATCA
AAAGTACCCCATGTTCCGCGAGAACTTTGACGAGCTCGACGACTCGCGCG
AGGTCGTGCAGGGCCTCATCGACGAGTACGAGGCGTGCGAGAACCGCGAC
TACCTCACCTGGGGCTCCCCGGCCGGCGGCATCGCGGGTTCGTCGGCTCA
GCAGACCTCGTACGGCCGGTCCGACGACATGGACTTGTCCGCGCGGCTCT
ACTGAGACACGGTGGGACCTTTGATATACCGAAAACAGTAATCTAC