Blastocladiella emersonii clone report

Clone ID BeCSAS2479
Best BLASTX Match gb|AAH09686.1|
Function Description PTS protein [Homo sapiens]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2479
CTACGCATCAACATCCACCGCACATCATGACCATGTCCTCGACCGCCGCC
GCCTCTGCCGCCTCGCCAAGACCGCGCCCCGTGGCCGTGATCTCGCGGGT
GGAAAAGTTCAGCGCGGCGCACCGTCTGCACTCGCCGCACCTGAGCGACG
CCGAGAACGCGGCCGTGTTCGGCAAGTGCAACCACGTTAACTTCCACGGC
CACAACTACACGCTGCGCGTCGACGTGCGCGGGCCTATCGACGCGGCGAC
AGGTATGTCTACCCCGCCTCGCTTGCGAATGAGGGTGCAAGACCCTGTTC
GAGTTGGCTGGCTGAGTTCGATGCAGCCGTCGTCCTCATCCTTTCCTCAC
TTCTCCCTCTCTTCCCCTTTCCTCGCGGCGACAGGCATGGTTGTCAACAT
CGCCGACCTCAAGCGGTGCCTCGCCGACACGGTGCTGGCCGAGTGCGACC
ACCGCAACCTCGACCTCGACGTGCCGTACTTTGCGCGCGAGCGCGTCCCG
AGCACCACCGAGAACCTCGCCGTCTACGTCTACCGCACGCTCGCCGCCGC
GCTGCCCAAGTACGTCGGCAAGACGGGCGACGGCGTCACCGCACCGCGGC
TCGACAAGGTCACGCTGTGGGAGACGGACAAGAACATCGTCGAGTACTCG
GAGCCTTACGTGGCCGACGACGGCGAGCTGCTCGTGCGCTAGCTAGATTA
AACATCCGTTCTGTTC