Blastocladiella emersonii clone report

Clone ID BeCSAS2475
Best BLASTX Match gb|AAG31434.1|
Function Description snRNP core protein SMX5d [Mus musculus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2475
GCTTGCTATCGTGACGCGCGCGGGAGCCGAAACATGGTCTGTCACCTCCG
CCCTGCGGCGCCCAGGCACCCCCTTGTCGGCACAAAGGCCGTCCAGGCCG
GCTGACTGGGCATGAATGAATGAAGGATCGGGTCGCTGACGCTGGCCTCT
CGCTGCGCGCACCAGTAGCTGTTCTACTCCTTCTTCAAGACGCTGGTCGG
GCGCACCGTGACGGTGGAGCTCAAGAACGACATGACCATGGAGGGCACGC
TCGCGTCCGTCGACCAGTTCCTCAACATCAAGCTCGACAACGTGCGCGTC
ACGGACGCGGCGCGGTACCCGCACGTCATGACGCTTAAGAACTGCTTCAT
CCGCGGGTCGGTCGTGCGCTACGTGAACCTGCCCGCGCAGCACGTCGACA
CGGCGCTGCTGCAGGACGCGACGCGCCGGGAAGCCATGAACAACGCCCGC
CGGTGAGCCTGCGCGTGCACACTGGTTTGGTAGCTCGTGTCAACAGTAAA
TACATCTATAAAATCGTGTAAATGTC