Blastocladiella emersonii clone report

Clone ID BeCSAS2473
Best BLASTX Match ref|YP_478092.1|
Function Description isopenicillin N-epimerase [Synechococcus sp. JA-2-3B\'a(2-13)]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2473
TGGTCCTCGACATCCCGCTCCCCACGCGCCTCGGCCCGTTCGACCGCCTG
CAGCGCGCCGTGGAGCGTCCGGGCGACCTAGCCGAGGGCGCGACGCTGCT
GCCGCCGCGCGTGCAGGCCGCCATGGCCGCCGTAGCCGACGACGCGCGGG
TCCCGCTCGAGCGCCACCGCGACCTGTACTCGCTGCGCCGCGACGTGACC
TTCCTCAACCACGGCAGCTACGGGTGCGTGCCCAAGTCGGTGCAGGCCGT
GCGCCGCGTGTGGATGGACCTGAGCGAGGAGGAGCCCATCGACTTCGGCG
CCGAGATCGACACGGCCGTCGCCTGGGCCGAGCGCGAGGTCGCGCAGTTC
GTGAACGCGGACCCGCGCGACGTCGTCTTCTGCGCCAACGCGTCGACGGG
GACCAACATCGTGCTCAAGTCGCTGAACCTCGGGCCCGCCGACACGATTC
TGCGCATCAGCCTCGCGTACCCGGCCGTCACCTCGACCATCGCGCACCTC
GTCGCGACCACGGGCGTCAAGTCGTTCGAGCTGTCGATCCCGCTGCCCAC
TACCAAGGCCGCCATCGTGCGCCGCTTCGAGGAGTACTTCCGCACCTCGT
GCGCGACGCCAACCATCGCCGTCTTCGACCACATCACCAGCGCCACGGGG
CTCGTGCTGCCCGTCGCCGAGCTCGTCGCCATCTGCCGCACGCACGGCGT
GCTGTCGCTGATCGACGGCGCGCACGCCGTCGGCCAGGTGCCCGTCGACC
TGCGCGCCATGGACCCCGACTTCTACGTCTCCAACTGCCACAAGTGGCTG
TTCGCGCCGCGCGGGTGCGCCTTCCTGTACACCAAGCGCCAGTGGCACCC
GCGCATCTTCCACGTCGTGACGTCGTACGGGCTCGGCAAGGGGTACCAGG
CCGAGGGCTTCTGGCCGGGGACGTTTGACCCGAGCTGCCTCCTGTCGGCG
CCCGCGGGCATCGCCTTCTTCCGCCACGTCCTCGGCGGGTCCGTCGCGCG
CAACCACCTGCTCGCCGTCCGGACCGCCAAGTTCCTCGCCGCGGCGCTCG
AGGGCACGCTGCTCGTCGACCAGTGGGACGCCGAGGCGCCGCACCTGATC
GGTACCCTCGCCACGGTCCTGCTGCCGCGCCTGACGCCCGGGTCCGCGAC
GGCCGACGCCGTGAT