Blastocladiella emersonii clone report

Clone ID BeCSAS2472
Best BLASTX Match ref|XP_757161.1|
Function Description hypothetical protein UM01014.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2472
CTCGAGCCCGTCGTCCCCGTCGGGGATGCTGCGGGTCCTCCGCCGCGCCG
TGGCCTCGCTCGTGCTGCTCGCGCTCTGCGTGGCGCTGGCCCGCGCCTCC
CCCGCCGGCTCGGCGCAGTCGCCCAACAACGTCGTCGAGCTCACCACGGC
CGACTTTGCCGCCAAGACCAAGACGGGCACCTGGTTCGTCGAGTTCTTTG
CCCCCTGGTGCCCGCACTGCAAGCGGCTCGCGCCCAAGTGGGCCAAGCTG
AGCAACGAGCTCAAGCCGTGGGTCGAGTCCAAGGACTTCCACATTGCGCG
CGTCAACTGCGTCGCCGAGTCGGACCTGTGCGACACGGTCGGCATTGACG
GCTTCCCGACGCTGTTCCTCTACCACAAGGGCGAGAAGAAGGAGGAGTAC
GAGGGCGAGCGCAAGTTCGACGACATTCTCCAGTACGCGACCGCCGTCGC
CGCCAAGTTCCCCAACACACCCGCCCCGCCCGCCAGCATCCCCGATGTGC
CCAAAGTCAAGGTCGACGTTCCCGCCGCCGTCCCCGTTGCCGCTGCTGCC
GCCTCGTCCGGCAACAAGCACACGCCTGCCAAGGCCGCCCAGGACTCCTC
CTCGTCGTCTTCGTCGTCGTCGGAGATCTCGCCCGAGCT