Blastocladiella emersonii clone report

Clone ID BeCSAS2470
Best BLASTX Match gb|AAW40957.1|
Function Description t-complex protein 1, beta subunit (tcp-1-beta), putative [Cryptococcus neoformans var. neoformans JEC21]



The following sequence was assigned to this function:

Sequence ID Sequence
BeCSAS2470
CTCCTCGACTCGTACCTCGACGAGGGCTTCATCCTCGACAAGAAGATTGG
CGTCAACTGCCCGAAGCGCATCGAGAACGCGACCATCCTGATCGCTAACA
CGCCCATGGACACGGACAAGATCAAGGTGTTCGGCGCGCGCGTCCGCGTC
GACGCGACGGGCAAGCTCGCCGAGCTCGAGCGCGCCGAGCGCGACAAGAT
GCGCGACAAGGTCGACAAGATCAAGGCCCACGGCATCAACTGCTTTGTCA
ACCGCCAGCTCATCTACAACTGGCCCGAGCAGCTGTTCGCCGACGCCGGC
ATCGCGTCCATCGAGCACGCCGATTTCGACGGCGTCGAGCGCCTCGCGCT
CGTGACGGGCGGGGAGATCGCGTCGACCTTTGACCACCCCGAGCTCGTCA
AGCTCGGCAAGTGCAAGCTGATCGAGGAGATCATGATCGGCGAGGACAAG
CTCATCAAGTTCTCGGGGGTCGCCGCCGGCGAGGCATGCACGGTCGTCCT
GCGCGGCGCCACGCACCAGCTTCTCGACGAGGCCGAGCGGTCCCTGCACG
ACGCGCTCGCGGTCCTGTCGCAGACGGTCAAGGAGACGCGCACGGTGCTC
GGCGGCGGGTGCTCGGAGATGCTCATGTCCAAGGCCGTCGACGAGGCCGC
GGCCACCACGGCCGGCAAGAAGGCCATGGCCGTCGAGGCGTTTGCGCGCG
CGCTGCGCCAGATGCCCACGATCCTCGCCGACAACGCGGGTTACGACTCG
TCGGACCTGGTCGCTCGGCTCCGCGCGGCGCACTACGCCGGCAAGACGAC
GGCCGGGCTCGACATGGACAAGGGCGACGTCGGAGACGTGCGCGACCTCG
GCATCACCGAGTCGTACAAGCTCAAGCGCCAGGTGGTCCTGTCCGCGTCC
GAGGCCGCCGAGATGATCCTCCGCGTCGACGATATCCTCCGCGCCGCGCC
GCGCCAGCGCTCGCGCCAGTAACTGACCGTGTAGTTCTCTGATTTTTGTG
GTTTCTCCTTTTTGTTGTTCTTTTCAAATGTAACAGTTAACTTGCAACAC